Review



sirab7  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology sirab7
    Sirab7, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sirab7/Rab+7+siRNA/pmc05599755-566-52-61
    Average 93 stars, based on 17 article reviews
    sirab7 - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Negative Control:

    Article Title: Entry of Classical Swine Fever Virus into PK-15 Cells via a pH-, Dynamin-, and Cholesterol-Dependent, Clathrin-Mediated Endocytic Pathway That Requires Rab5 and Rab7
    Article Snippet: .. The siRNAs used in study were siCHC (AACCUGCGGUCUGGAGUCAAC) for the clathrin heavy chain (CHC) ( 37 ) and siCav (CACACAGUUUCGAUGGCAUCUTT) for caveolin-1 ( 38 ); siRNA for Rab5 (siRab5) (catalog number sc-36344), siRab7 (catalog number sc-29460), and the negative control (catalog number sc-37007) were obtained from Santa Cruz Biotechnology. ..

    Article Title: Rab5 and Rab11 Are Required for Clathrin-Dependent Endocytosis of Japanese Encephalitis Virus in BHK-21 Cells
    Article Snippet: To measure the replication of JEV in cells transfected with dominant negative mutants, cells were grown to 70% confluence on coverslip dishes and transfected with 2.5 μg of the plasmid indicated on the figures using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. .. For RNA knockdown, BHK-21 cells were seeded in a six-well plate at 2.5 × 10 5 cells/well and then transfected with 100 nM siRNA using Lipofectamine 3000 according to the manufacturer's instructions. siRNA duplexes used in the study are as follows: clathrin heavy chain (sc-35067), caveolin-1 (sc-29241), V-ATPase B1 (sc-36787), siRab5 (sc-36344), siRab7 (sc-29460), siRab9 (sc-44065), the negative-control siRNA (sc-37007) (all, Santa Cruz Biotechnology), and siRab11 (317644A10; Invitrogen). ..

    Knockdown:

    Article Title: Rab5 and Rab11 Are Required for Clathrin-Dependent Endocytosis of Japanese Encephalitis Virus in BHK-21 Cells
    Article Snippet: To measure the replication of JEV in cells transfected with dominant negative mutants, cells were grown to 70% confluence on coverslip dishes and transfected with 2.5 μg of the plasmid indicated on the figures using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. .. For RNA knockdown, BHK-21 cells were seeded in a six-well plate at 2.5 × 10 5 cells/well and then transfected with 100 nM siRNA using Lipofectamine 3000 according to the manufacturer's instructions. siRNA duplexes used in the study are as follows: clathrin heavy chain (sc-35067), caveolin-1 (sc-29241), V-ATPase B1 (sc-36787), siRab5 (sc-36344), siRab7 (sc-29460), siRab9 (sc-44065), the negative-control siRNA (sc-37007) (all, Santa Cruz Biotechnology), and siRab11 (317644A10; Invitrogen). ..

    Transfection:

    Article Title: Rab5 and Rab11 Are Required for Clathrin-Dependent Endocytosis of Japanese Encephalitis Virus in BHK-21 Cells
    Article Snippet: To measure the replication of JEV in cells transfected with dominant negative mutants, cells were grown to 70% confluence on coverslip dishes and transfected with 2.5 μg of the plasmid indicated on the figures using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. .. For RNA knockdown, BHK-21 cells were seeded in a six-well plate at 2.5 × 10 5 cells/well and then transfected with 100 nM siRNA using Lipofectamine 3000 according to the manufacturer's instructions. siRNA duplexes used in the study are as follows: clathrin heavy chain (sc-35067), caveolin-1 (sc-29241), V-ATPase B1 (sc-36787), siRab5 (sc-36344), siRab7 (sc-29460), siRab9 (sc-44065), the negative-control siRNA (sc-37007) (all, Santa Cruz Biotechnology), and siRab11 (317644A10; Invitrogen). ..



    Similar Products

    sirab7  (Shanghai Genechem Ltd)
    90
    Shanghai Genechem Ltd sirab7
    HASMC proliferation and invasion is regulated by Rab7 in vitro . (A) Transfection efficiency was demonstrated for the Case 4 knockdown and Case 8 overexpression using western blot analysis. (B) Rab7 knockdown inhibited Case 4 HASMC proliferation and overexpression promoted Case 8 HASMC proliferation as determined by an EdU assay. **P<0.01 and ***P<0.001 vs. CON. Scale bar=200 µm. (C) In vitro , HASMC invasion decreased in the Rab7 knockdown group and increased in the Rab7 overexpression group compared with the respective controls. **P<0.01 vs. CON. Scale bar=200 µm. (D and F) HASMC cell cycle was regulated by Rab7 in vitro . Rab7 knockdown induced G1 arrest in Case 4 HASMCs compared with the control (**P<0.01 vs. CON); the proportion of cells in the S phase was increased (**P<0.01 vs. CON) and the proportion of cells in G2 phase markedly changed (P>0.05 vs. CON). (E and G) Rab7 overexpression in Case 8 HASMCs increased the number of cells in G1 phase (**P<0.01 vs. CON); the number of cells in S phase decreased (***P<0.001 vs. CON) and that of G2 cells markedly changed (P>0.05 vs. CON). CON, control; EdU, 5′ethynyl-2′-deoxyuridine; HASMCs, human aortic smooth muscle cells; siCtrl, small interfering RNA control; <t>siRab7,</t> siRNA Rab7.
    Sirab7, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sirab7/sirab7/pmc06423587-50-0-10
    Average 90 stars, based on 1 article reviews
    sirab7 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    sirab7  (Santa Cruz Biotechnology)
    93
    Santa Cruz Biotechnology sirab7
    HASMC proliferation and invasion is regulated by Rab7 in vitro . (A) Transfection efficiency was demonstrated for the Case 4 knockdown and Case 8 overexpression using western blot analysis. (B) Rab7 knockdown inhibited Case 4 HASMC proliferation and overexpression promoted Case 8 HASMC proliferation as determined by an EdU assay. **P<0.01 and ***P<0.001 vs. CON. Scale bar=200 µm. (C) In vitro , HASMC invasion decreased in the Rab7 knockdown group and increased in the Rab7 overexpression group compared with the respective controls. **P<0.01 vs. CON. Scale bar=200 µm. (D and F) HASMC cell cycle was regulated by Rab7 in vitro . Rab7 knockdown induced G1 arrest in Case 4 HASMCs compared with the control (**P<0.01 vs. CON); the proportion of cells in the S phase was increased (**P<0.01 vs. CON) and the proportion of cells in G2 phase markedly changed (P>0.05 vs. CON). (E and G) Rab7 overexpression in Case 8 HASMCs increased the number of cells in G1 phase (**P<0.01 vs. CON); the number of cells in S phase decreased (***P<0.001 vs. CON) and that of G2 cells markedly changed (P>0.05 vs. CON). CON, control; EdU, 5′ethynyl-2′-deoxyuridine; HASMCs, human aortic smooth muscle cells; siCtrl, small interfering RNA control; <t>siRab7,</t> siRNA Rab7.
    Sirab7, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sirab7/Rab+7+siRNA/pmc05599755-566-52-61
    Average 93 stars, based on 1 article reviews
    sirab7 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    sirna sirab7  (Qiagen)
    90
    Qiagen sirna sirab7
    Cultured NRVMs were infected with adenoviruses to express GFPu and RFP (Ad-GFPu/RFP) 24 hours before transfection with siRNA for Atg7 (siAtg7), <t>Rab7</t> <t>(siRab7)</t> and/or for p62 (sip62). A luciferase-specific siRNA (siLuc) was used as control for siRNA infection and off-target effects. The cells were harvested at 48 h later for extracting total proteins. A , Shown are representative images out of 3 repeats. B , pooled densitometry data. *p<0.05 vs. CTL.
    Sirna Sirab7, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sirab7/small+interference+rna+sirab7+1/pmc04069113-90-15-37
    Average 90 stars, based on 1 article reviews
    sirna sirab7 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    small interference rna sirab7-1  (Qiagen)
    90
    Qiagen small interference rna sirab7-1
    Cultured NRVMs were infected with adenoviruses to express GFPu and RFP (Ad-GFPu/RFP) 24 hours before transfection with siRNA for Atg7 (siAtg7), <t>Rab7</t> <t>(siRab7)</t> and/or for p62 (sip62). A luciferase-specific siRNA (siLuc) was used as control for siRNA infection and off-target effects. The cells were harvested at 48 h later for extracting total proteins. A , Shown are representative images out of 3 repeats. B , pooled densitometry data. *p<0.05 vs. CTL.
    Small Interference Rna Sirab7 1, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sirab7/small+interference+rna+sirab7+1/10__1161_slash_circulationaha__111__048934-220-2-26
    Average 90 stars, based on 1 article reviews
    small interference rna sirab7-1 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    HASMC proliferation and invasion is regulated by Rab7 in vitro . (A) Transfection efficiency was demonstrated for the Case 4 knockdown and Case 8 overexpression using western blot analysis. (B) Rab7 knockdown inhibited Case 4 HASMC proliferation and overexpression promoted Case 8 HASMC proliferation as determined by an EdU assay. **P<0.01 and ***P<0.001 vs. CON. Scale bar=200 µm. (C) In vitro , HASMC invasion decreased in the Rab7 knockdown group and increased in the Rab7 overexpression group compared with the respective controls. **P<0.01 vs. CON. Scale bar=200 µm. (D and F) HASMC cell cycle was regulated by Rab7 in vitro . Rab7 knockdown induced G1 arrest in Case 4 HASMCs compared with the control (**P<0.01 vs. CON); the proportion of cells in the S phase was increased (**P<0.01 vs. CON) and the proportion of cells in G2 phase markedly changed (P>0.05 vs. CON). (E and G) Rab7 overexpression in Case 8 HASMCs increased the number of cells in G1 phase (**P<0.01 vs. CON); the number of cells in S phase decreased (***P<0.001 vs. CON) and that of G2 cells markedly changed (P>0.05 vs. CON). CON, control; EdU, 5′ethynyl-2′-deoxyuridine; HASMCs, human aortic smooth muscle cells; siCtrl, small interfering RNA control; siRab7, siRNA Rab7.

    Journal: Molecular Medicine Reports

    Article Title: Rab7-mediated autophagy regulates phenotypic transformation and behavior of smooth muscle cells via the Ras/Raf/MEK/ERK signaling pathway in human aortic dissection

    doi: 10.3892/mmr.2019.9955

    Figure Lengend Snippet: HASMC proliferation and invasion is regulated by Rab7 in vitro . (A) Transfection efficiency was demonstrated for the Case 4 knockdown and Case 8 overexpression using western blot analysis. (B) Rab7 knockdown inhibited Case 4 HASMC proliferation and overexpression promoted Case 8 HASMC proliferation as determined by an EdU assay. **P<0.01 and ***P<0.001 vs. CON. Scale bar=200 µm. (C) In vitro , HASMC invasion decreased in the Rab7 knockdown group and increased in the Rab7 overexpression group compared with the respective controls. **P<0.01 vs. CON. Scale bar=200 µm. (D and F) HASMC cell cycle was regulated by Rab7 in vitro . Rab7 knockdown induced G1 arrest in Case 4 HASMCs compared with the control (**P<0.01 vs. CON); the proportion of cells in the S phase was increased (**P<0.01 vs. CON) and the proportion of cells in G2 phase markedly changed (P>0.05 vs. CON). (E and G) Rab7 overexpression in Case 8 HASMCs increased the number of cells in G1 phase (**P<0.01 vs. CON); the number of cells in S phase decreased (***P<0.001 vs. CON) and that of G2 cells markedly changed (P>0.05 vs. CON). CON, control; EdU, 5′ethynyl-2′-deoxyuridine; HASMCs, human aortic smooth muscle cells; siCtrl, small interfering RNA control; siRab7, siRNA Rab7.

    Article Snippet: siRab7, and Rab7 overexpression and control vectors were obtained from Shanghai GeneChem Co., Inc. (Shanghai, China).

    Techniques: In Vitro, Transfection, Knockdown, Over Expression, Western Blot, EdU Assay, Control, Small Interfering RNA

    HASMC autophagy is regulated by Rab7 in vitro . (A) Immunofluorescence assays revealed that LC3 expression was decreased in Rab7 knockdown cells compared with the control (Case 4; ***P<0.001 vs. Ctrl) and upregulated in Rab7 overexpressing HASMCs compared with the control (Case 8; **P<0.01 vs. Ctrl). Scale bar=200 µm. (B) Rab7, Beclin1 and LC3-II protein levels decreased in siRab#1 and siRab#2 groups, and P62 protein levels were increased compared with the siCtrl group (Case 4) as determined by western blotting. Overexpression of Rab7 notably increased the expression of Rab7, Beclin1 and LC3-II, and downregulated that of P62 levels compared with the control (Case 8). Scale bar=200 µm. Ctrl, control; HASMCs, human aortic smooth muscle cells; LC3, microtubule-associated protein light chain 3; siCtrl, small interfering RNA control; siRab7, siRNA Rab7.

    Journal: Molecular Medicine Reports

    Article Title: Rab7-mediated autophagy regulates phenotypic transformation and behavior of smooth muscle cells via the Ras/Raf/MEK/ERK signaling pathway in human aortic dissection

    doi: 10.3892/mmr.2019.9955

    Figure Lengend Snippet: HASMC autophagy is regulated by Rab7 in vitro . (A) Immunofluorescence assays revealed that LC3 expression was decreased in Rab7 knockdown cells compared with the control (Case 4; ***P<0.001 vs. Ctrl) and upregulated in Rab7 overexpressing HASMCs compared with the control (Case 8; **P<0.01 vs. Ctrl). Scale bar=200 µm. (B) Rab7, Beclin1 and LC3-II protein levels decreased in siRab#1 and siRab#2 groups, and P62 protein levels were increased compared with the siCtrl group (Case 4) as determined by western blotting. Overexpression of Rab7 notably increased the expression of Rab7, Beclin1 and LC3-II, and downregulated that of P62 levels compared with the control (Case 8). Scale bar=200 µm. Ctrl, control; HASMCs, human aortic smooth muscle cells; LC3, microtubule-associated protein light chain 3; siCtrl, small interfering RNA control; siRab7, siRNA Rab7.

    Article Snippet: siRab7, and Rab7 overexpression and control vectors were obtained from Shanghai GeneChem Co., Inc. (Shanghai, China).

    Techniques: In Vitro, Immunofluorescence, Expressing, Knockdown, Control, Western Blot, Over Expression, Small Interfering RNA

    HASMC phenotypic transformations are regulated by Rab7 in vitro . (A) Western blotting revealed Rab7 downregulation in Case 4 HASMCs. Following Rab7 knockdown, α-SMA expression was notably increased and osteopontin levels were decreased compared with the control. ***P<0.001 vs. CON. (B) Overexpression of Rab7 promoted phenotypic transformation in Case 8 HASMC as indicted by alterations in the expression of α-SMA and osteopontin. 3-MA was used to inhibit autophagy; the expression of α-SMA and osteopontin was markedly altered in Rab7-overexpressing cells (Case 8). ***P<0.001, *P<0.05 vs. CON. 3-MA, 3-methyladenine; Ctrl, control; HASMC, human aortic smooth muscle cells; LC3, microtubule-associated protein light chain 3; siCtrl, small interfering RNA control; siRab7, siRNA Rab7.

    Journal: Molecular Medicine Reports

    Article Title: Rab7-mediated autophagy regulates phenotypic transformation and behavior of smooth muscle cells via the Ras/Raf/MEK/ERK signaling pathway in human aortic dissection

    doi: 10.3892/mmr.2019.9955

    Figure Lengend Snippet: HASMC phenotypic transformations are regulated by Rab7 in vitro . (A) Western blotting revealed Rab7 downregulation in Case 4 HASMCs. Following Rab7 knockdown, α-SMA expression was notably increased and osteopontin levels were decreased compared with the control. ***P<0.001 vs. CON. (B) Overexpression of Rab7 promoted phenotypic transformation in Case 8 HASMC as indicted by alterations in the expression of α-SMA and osteopontin. 3-MA was used to inhibit autophagy; the expression of α-SMA and osteopontin was markedly altered in Rab7-overexpressing cells (Case 8). ***P<0.001, *P<0.05 vs. CON. 3-MA, 3-methyladenine; Ctrl, control; HASMC, human aortic smooth muscle cells; LC3, microtubule-associated protein light chain 3; siCtrl, small interfering RNA control; siRab7, siRNA Rab7.

    Article Snippet: siRab7, and Rab7 overexpression and control vectors were obtained from Shanghai GeneChem Co., Inc. (Shanghai, China).

    Techniques: In Vitro, Western Blot, Knockdown, Expressing, Control, Over Expression, Transformation Assay, Small Interfering RNA

    Rab7 promotes the Ras/Raf/MEK/ERK signaling pathway. Expression of proteins associated with the Ras/Raf/MEK/ERK signaling pathway in Rab7 knockdown (A; Case 4) and overexpression (B; Case 8) in human aortic smooth muscle cells were analyzed by western blotting. MAPK, mitogen-activated protein kinase; MEK, MAPK kinase; p, phosphorylated; siRab7, small interfering RNA Rab7.

    Journal: Molecular Medicine Reports

    Article Title: Rab7-mediated autophagy regulates phenotypic transformation and behavior of smooth muscle cells via the Ras/Raf/MEK/ERK signaling pathway in human aortic dissection

    doi: 10.3892/mmr.2019.9955

    Figure Lengend Snippet: Rab7 promotes the Ras/Raf/MEK/ERK signaling pathway. Expression of proteins associated with the Ras/Raf/MEK/ERK signaling pathway in Rab7 knockdown (A; Case 4) and overexpression (B; Case 8) in human aortic smooth muscle cells were analyzed by western blotting. MAPK, mitogen-activated protein kinase; MEK, MAPK kinase; p, phosphorylated; siRab7, small interfering RNA Rab7.

    Article Snippet: siRab7, and Rab7 overexpression and control vectors were obtained from Shanghai GeneChem Co., Inc. (Shanghai, China).

    Techniques: Expressing, Knockdown, Over Expression, Western Blot, Small Interfering RNA

    Cultured NRVMs were infected with adenoviruses to express GFPu and RFP (Ad-GFPu/RFP) 24 hours before transfection with siRNA for Atg7 (siAtg7), Rab7 (siRab7) and/or for p62 (sip62). A luciferase-specific siRNA (siLuc) was used as control for siRNA infection and off-target effects. The cells were harvested at 48 h later for extracting total proteins. A , Shown are representative images out of 3 repeats. B , pooled densitometry data. *p<0.05 vs. CTL.

    Journal: PLoS ONE

    Article Title: Autophagic-Lysosomal Inhibition Compromises Ubiquitin-Proteasome System Performance in a p62 Dependent Manner in Cardiomyocytes

    doi: 10.1371/journal.pone.0100715

    Figure Lengend Snippet: Cultured NRVMs were infected with adenoviruses to express GFPu and RFP (Ad-GFPu/RFP) 24 hours before transfection with siRNA for Atg7 (siAtg7), Rab7 (siRab7) and/or for p62 (sip62). A luciferase-specific siRNA (siLuc) was used as control for siRNA infection and off-target effects. The cells were harvested at 48 h later for extracting total proteins. A , Shown are representative images out of 3 repeats. B , pooled densitometry data. *p<0.05 vs. CTL.

    Article Snippet: The siRNA's specific for rat p62 (sip62: 5′- CATGTCCTATGTGAAAGATGA-3′ ), Atg7 (siAtg7: Cat. # SI01729119), Rab7 (siRab7: Cat. # SI03021725) and the siRNA targeting luciferase serving as a control siRNA (siLuc: 5′-AACGTACGCGGAATACTTCGA-3′ ) were all purchased from Qiagen (Valencia, CA).

    Techniques: Cell Culture, Infection, Transfection, Luciferase, Control